microRNA Marker

Avalie o Produto
(0 votos)

 

Catalog nº Size Concentration
N2102S    100 gel lanes    12 ng/μl 

Description:
The microRNA Marker is a set of three synthetic single-stranded RNA oligonucleotides 17, 21 and 25 residues long that have free 5´ ends (i.e., no 5´ phosphate groups). These oligonucleotides can be used as size markers on denaturing polyacrylamide gels and Northern blots. The microRNA Marker is best visualized by staining with SYBR-Gold instead of ethidium bromide (Figure 1).

The three marker oligos contain the same core sequence so they can be detected by hybridization with the same probe. The sequences of the microRNA marker band are as follows:



25-mer: 5´AGAGCAGUGGCUGGUUGAGAUUUAA 3´
21-mer: 5´AGCAGUGGCUGGUUGAGAUUU 3´
17-mer: 5´CAGUGGCUGGUUGAGAU 3´

Note: The sequence in bold is common to all three oligos.



A 21-mer DNA oligonucleotide complementary to the marker sequences is included. This oligonucleotide is biotinylated at the 3´ end and has a free 5´ end so it can also be labeled with γ-32P-ATP and T4 Polynucleotide Kinase (NEB# M0201). The sequence of the oligonucleotide probe is as follows:

5´AAATCTCAACCAGCCACTGCT 3´-Biotin



Supplied in: The microRNA Marker is provided in 4 M urea and 0.04% Orange G loading buffer. The probe is supplied in water.

Figure 1: Lane A: 60 ng of microRNA Marker(5 µl) was loaded on a 12% denaturing polyacrylamide-urea gel which was stained with SYBR Gold (Molecular Probes) for 5 minutes and photographed on a transilluminator. Lane B: 0.2 µg of the Low Range ssRNA Marker (NEB #N0364).

Recommended Load: 60 ng




Storage Conditions


Storage Temperature:

-20°C

Notes


Usage notes:


   1. The microRNA Marker is provided in a ready-to-load denaturing solution. Denature by heating for 3-5 minutes at 95°C and place on ice. Load 5-10 µl for staining with SYBR Gold in denaturing gels. In Northern blots, less than 1 µl (12 ng) is sufficient for detection by hybridization.

      The Orange G loading buffer migrates faster than the smallest band, and migrates approximately as far as the nucleotides.
   2. Oligonucleotide Probe Usage: The provided biotinylated probe DNA oligonucleotide can be used directly in hybridization and detected with the Phototope Star Detection Kit (NEB #N7020). Use 1 to 10 µl of Probe (20-200 ng) per 10 ml hybridization solution. Hybridize and wash the blot at 35-40°C depending on the hybridization solution used. More details can be found in reference 1 and the Phototope Star Detection Kit manual.

      Alternatively, the probe can be labeled with T4 Polynucleotide Kinase (NEB #M0201) and radioactive γ-32P-ATP using the following protocol:

      1. Mix the following components in a sterile microfuge tube:
      Oligonucleotide Probe -- 1-5 µl
      10X T4 Polynucleotide Kinase reaction Buffer -- 2.0 µl
      γ-32P-ATP (5 µCi/µl) -- 1-2 µl
      T4 Polynuclotide Kinase -- 1 µl
      Sterile dH20 -- X µl
      Total volume -- 20 µl

      2. Incubate for 30 minutes at 37°C.

      3. Purify labeled probe using a G-25 spin column.





References


   1. Sambrook, J. and Russel, D.W. (2001) Molecular Cloning: A Laboratory Manual (3rd Ed.), 7.1-7.56.





Companion Products


Low Range ssRNA Ladder
Phototope®-Star Detection Kit
siRNA Marker
T4 Polynucleotide Kinase   

microRNA Marker FAQ

Q1: Can I use the microRNA Marker on a non-denaturing gel?

Q2: Should I denature the microRNA Marker before loading on my gel?Q3: Can I visualize the microRNA Marker using EtBr staining?Q4: What is the difference between the siRNA marker and the microRNA marker (NEB #N2102S)?Q1: Can I use the microRNA Marker on a non-denaturing gel?

A1: This product is not recommended for use on non-denaturing gels. The microRNA marker is intended for measuring the size of small ssRNA molecules on a denaturing gel. It is supplied in a denaturing buffer for that purpose.


Q2: Should I denature the microRNA Marker before loading on my gel?

A2: Yes. The microRNA marker is supplied in a denaturing loading buffer. It can be heated at 95°C for 5 minutes then chilled on ice before loading.

Q3: Can I visualize the microRNA Marker using EtBr staining?

A3: We recommend using SYBR-Gold (Invitrogen) staining for visualizing the microRNA Marker because SYBR Gold is more sensitive than ethidium bromide staining. Visualization using ethidium bromide staining may require loading more microRNA marker.

Q4: What is the difference between the siRNA marker and the microRNA marker (NEB #N2102S)?

A4: The siRNA marker (NEB #N2101S) is consisted of three synthetic non-phosphorylated RNA duplexes. This marker is used for measuring the size of small dsRNA molecules such as siRNA. The siRNA Marker should not be denatured prior to electrophoresis on a native gel. The microRNA marker (NEB #N2102S) is composed of three synthetic non-phosphorylated single-stranded RNA molecules supplied a denaturing buffer. This marker is used for measuring the size of small ssRNA such as microRNA molecules. The microRNA Marker is used in denaturing gels and stained with SYBR® Gold (Invitrogen) for visualization. This marker can also be detected via hybridization using the provided biotinylated probe. In addition, this biotinylated probe can be labeled with γ32P-ATP using T4 Polynucleotide Kinase (NEB #M0201S), since the probe has a free 5’-end.

Deixe um comentário


DESENHE SEUS PRIMERS!

Pesquise seu item

 

Receba Promoções

Assistência Técnica