Equipamentos para Laboratórios | Equipamento para Laboratório

Description:
Chemically competent Kluyveromyces lactis YCT390 (∆yps7) cells are a suitable host for expressing proteins that have exhibited proteolysis in the parental GG799 background (NEB #C1001). YCT390 cells can be transformed with any linearized pKLAC-series or pKLMF-series expression vector. K. lactis strain YCT390 carries a selectable marker-free deletion of the KLLA0F22088g locus encoding an extracellular aspartyl protease (KlYps7p) that is homologous to S. cerevisiae Yps7p.

Strain: K. lactis strain YCT390 (∆yps7). No auxotrophies or genetic markers.

Reagents Supplied with Cells: NEB Yeast Transformation Reagent (NEB #M2570). Store at 4°C.


Storage Conditions


Storage Temperature: -80°C


Notes


General notes:

   1. Store Competent Cells at -80°C. Once Thawed, Do Not Re-freeze

Usage notes:

   1. Due to the high transformation efficiency of K. lactis YCT390 Competent Cells, plating multiple dilutions of the cell mixture is necessary to ensure formation of plates with distinct single colonies. Growth time should not exceed 5 days as small colonies that lack an integrated expression fragment may form.

      Plates containing colonies can be stored at 4°C for up to two weeks.

      Growth of K. lactis YCT390 Competent Cells carrying an integrated expression vector for protein expression should be performed in YPGal medium (1% yeast extract, 2% peptone, 2% galactose) supplemented with a final concentration of 38 mM (NH4)2SO4. In the absence of 38 mM (NH4)2SO4, YCT390 cells will grow slower than the GG799 parent strain (NEB #C1001).

      The deletion of locus KLLA0F22088g in YCT390 can be confirmed by PCR using the primers AGAAAACTGAAAATGTATAAA and TGCTGCGACAAGTACGTATT to amplify a 2.3 kb diagnostic fragment. 

FAQs


Q1: Why does NEB offer K. lactis protease deletion strains?

A1: In all yeasts, host secetory pathway proteases may adversely affect the quality of a secreted recombinant protein. In K. latics, the offending protease is most often an apartyl protease from the protein family pfam00026. We developed an isogenic set of four aspartyl protease deletion strains as a means to address detrimental proteolysis. Each strain harbors a marker-free deletion of a single K. latics gene encoding a secretory pathway aspartyl protease that was identified by bioinformatic analysis of genomic sequence.


Q2: What K. lactis protease deletion strains does NEB sell?

A2: NEB sells four protease deletion strains:

NEB #C1003S: strain YCT569 (ΔKLLA0D01507g)
NEB #C1004S: strain YCT389 (Δyps1)
NEB #C1005S: strain YCT390 (Δyps7)
NEB #C1006S: strain YCT598 (Δbar1)

Each strain is sold in a frozen competent cell format and is ready to be transformed by any pKLAC-series or pKLMF-series vector. Additionally, NEB sells a sampler pack that combines one competent cell transformation reaction for each strain (NEB #C1007S).


Q3: Which protease deletion strain should i use?

A3: It is difficult to predict which secretory pathway protease(s) may adversely affect any given secreted recombinant protein's expression. If you suspect that your secreted recombinant protein is susceptible to proteolysis, you should try expression of your protein in each protease deletion strain and compare the quality and yield of the recombinant protein produced.


Q4: What vectors may be used with protease deletion strains?

A4: Protease deletion strains can be transformed by any pKLAC-series or pKLMF-series vector.


Q5: What is the parent background for the protease deletion strains?

A5: Protease genes were deleted from the wild-type K. latics GG799 background.


Protocols

Introduction


The following steps should be conducted using aseptic technique. Care should be taken to ensure that pipet tips, tubes, solutions and deionized water are sterilized prior to use.


Protocol


   1. Thaw a tube of K. lactis YCT390 Competent Cells on ice. Add 620 µl NEB Yeast Transformation Reagent to the cells. Briefly shake or invert the tube until the solution is homogeneous. Do not vortex.
   2. Add 1 µg of linearized pKLAC2 DNA containing the gene of interest to the cell mixture. Briefly shake or invert the tube to mix.

      Do not vortex. The total volume of transforming DNA should not exceed 15 µl.
   3. Incubate the mixture at 30°C for 30 minutes.
   4. Heat shock the cell mixture by incubation at 37°C for 1 hour in a water bath.
   5. Pellet cells by microcentrifugation at ~7000 r.p.m for 2 minutes and discard the supernatant.
   6. Resuspend the cell pellet in 1 ml sterile YPGlu medium (see Media & Solutions).
   7. Pellet cells by microcentrifugation at ~7000 r.p.m for 2 minutes and discard the supernatant.
   8. Resuspend the cell pellet in 1 ml YPGlu medium (see Media & Solutions) and transfer the cell mixture to a sterile culture tube. Incubate with shaking (250–300 r.p.m.) at 30°C for 3–4 hours.

      Incubations shorter than 3 hours are not recommended due to a decline in transformation efficiency.
   9. Transfer the cell mixture to a sterile 1.5 ml microcentrifuge tube. Pellet the cells by microcentrifugation at ~7000 r.p.m for 2 minutes and discard the supernatant. Resuspend the cell pellet in 1 ml sterile 1X PBS (see Media & Solutions).
  10. Remove 10, 50 and 100 µl of the cell suspension to separate fresh sterile 1.5 ml microcentrifuge tubes each containing 50 µl of sterile deionized water. Mix briefly and spread the entire cell mixture from each tube onto separate YCB Agar Medium plates containing 5 mM acetamide (see Media & Solutions). Incubate plates inverted at 30°C for 3–4 days until colonies form.
  11. Streak or patch 10–20 individual colonies onto fresh YCB Agar Medium plates containing 5 mM acetamide. Incubate at 30°C for 1–2 days.

      Patches of approximately 1.0 cm2 are recommended. Plates containing patched cells may be stored at 4°C for up to 3 days prior to performing whole-cell PCR (optional steps 12, 13).
  12. [OPTIONAL] Transformants can be tested to verify that they have correctly integrated the expression fragment.
  13. [OPTIONAL] Correctly integrated transformants can be further screened to identify cells that have integrated multiple tandem copies of the expression fragment.


Quality Control for Current Lot


Quality control values for a specific lot can be found on the datacard which accompanies each product.

Competency:
One microgram of linearized pKLAC1-malE was used to transform one tube of K. lactis YCT390 Competent Cells following the protocol provided. Greater than 1 x 104 colonies formed after a 3 day incubation at 30°C. Use of cells beyond the expiration date may result in lower transformation efficiency.

Sterility:
One tube of competent cells and 100 µl NEB Yeast Transformation Reagent were spread onto individual YCB Agar Medium plates containing 5 mM acetamide and incubated at 30°C for 3 days. No bacterial or fungal growth was detected.


Legal


Licenses/Patents/Disclaimers:
Notice to Buyer/User: K. lactis Competent Cells are a component of an expression system that was developed from basic research at New England Biolabs and DSM Biologics Company B.V. The buyer and user has a non-exclusive sublicense to use this system or any component thereof, including the K. lactis GG799, YCT284, YCT569, YCT389, YCT390 and YCT598 Competent Cells, for RESEARCH PURPOSES ONLY. A license to use this system for manufacture of clinical grade material or commercial purposes is available from New England Biolabs, Inc., or DSM Biologics Company B.V.